View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18328_low_33 (Length: 256)
Name: NF18328_low_33
Description: NF18328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18328_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 53 - 244
Target Start/End: Complemental strand, 40617026 - 40616835
Alignment:
| Q |
53 |
ggatctgcagctgtgtgggatgaattacggctgaataaaaatgatggtgtagtaccagttacatggactatggcttgaaagaatactcaagtagtggcta |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40617026 |
ggatctgcagctgtgtgggatgaattacggctgaataaaaatgatggtgtagtaccagttacatggactatggcttgaaagaatactcaagtagtggcta |
40616927 |
T |
|
| Q |
153 |
atatatataattaataagactaagcttaatttgcataaggtaaaattaagcttgtgtgtgttatttcgtcattttgttggtcctttgcttct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40616926 |
atatatataattaataagactaagcttaatttgcataaggtaaaattaagcttgtgtgtgttatttcgtcattttgttggtcctttgtttct |
40616835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 53 - 145
Target Start/End: Complemental strand, 40627737 - 40627646
Alignment:
| Q |
53 |
ggatctgcagctgtgtgggatgaattacggctgaataaaaatgatggtgtagtaccagttacatggactatggcttgaaagaatactcaagta |
145 |
Q |
| |
|
||||||| | |||||||| ||| |||| || |||||| | |||||||||||||||||||||||||| ||||||||| ||| | |||||||||| |
|
|
| T |
40627737 |
ggatctgtatctgtgtggaatgcattagggttgaatacagatgatggtgtagtaccagttacatggtctatggctt-aaaaattactcaagta |
40627646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 206
Target Start/End: Complemental strand, 40610406 - 40610364
Alignment:
| Q |
164 |
taataagactaagcttaatttgcataaggtaaaattaagcttg |
206 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
40610406 |
taataagaacaagcttaatttgcataaggttaaattaagcttg |
40610364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 131
Target Start/End: Complemental strand, 40610531 - 40610453
Alignment:
| Q |
53 |
ggatctgcagctgtgtgggatgaattacggctgaataaaaatgatggtgtagtaccagttacatggactatggcttgaa |
131 |
Q |
| |
|
||||||| |||||||||| ||| |||| || | |||| |||||||||| ||||||||||||||| |||| ||||||| |
|
|
| T |
40610531 |
ggatctgtagctgtgtggaatgcattagggttaaatactgatgatggtgtggtaccagttacatggtctatagcttgaa |
40610453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University