View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18328_low_38 (Length: 238)
Name: NF18328_low_38
Description: NF18328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18328_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 11 - 234
Target Start/End: Complemental strand, 36205106 - 36204872
Alignment:
| Q |
11 |
agaatatggctttggaatcacaaatgagtttgaaaaaatcacgatgacacacactatgaaactattgtataaaattgcacggaactatcaactgtcaaaa |
110 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36205106 |
agaaaatggctttggaatcacaa-tgagtttgaaaaaatcacgatgacacacactatgaaactattgtataaaattgcacgaaactatcaactgtcaaaa |
36205008 |
T |
 |
| Q |
111 |
gactctcatatcatggaggtactgtcaagc------------taccattaattagatcactataattcatgaaatcttttagttacatagattttgcaga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36205007 |
gactctcatatcatggaggtactgtcaagctattgtactgaataccattaattagatcactataattcatgaaatcttttagttacaaagattttgcaga |
36204908 |
T |
 |
| Q |
199 |
tacattacaaaatatgcaaaaaagacacataaatgt |
234 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36204907 |
tacattacaaaatatgcaaaaaagactcataaatgt |
36204872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University