View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18328_low_44 (Length: 203)
Name: NF18328_low_44
Description: NF18328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18328_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 46368473 - 46368643
Alignment:
| Q |
15 |
atcaggggtgtgagagtgagaatcagagtcttggggtttgggattggtgtttgtgttggtaggttgatcaccagcactactcatattgttgacttgagga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46368473 |
atcaggggtgtgagagtgagaatcagagtcttggggtttgggattgg------------taggttgatcaccagcactactcatattgttgacttgagga |
46368560 |
T |
|
| Q |
115 |
tcggattttgagtttctgattgatattttcaatctacgtgaatacgtgggtgggacttgaattcaaatatcaaaatgatgatg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46368561 |
tcggattttgagtttctgattgatattttcaatttacgtgaatacgtgggtgggacttgaattcaaatatcaaaatgatgatg |
46368643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University