View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18329_high_15 (Length: 267)
Name: NF18329_high_15
Description: NF18329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18329_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 3 - 253
Target Start/End: Complemental strand, 43963518 - 43963268
Alignment:
| Q |
3 |
tcgagtgagaagaaaggctctgcaaatttcttggagcaatagtatactcatatttgacgaagctcacaacctggtacgaagatttactaataaattaccg |
102 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43963518 |
tcgagggaaaagaaaggctctgcaaatttcttggagcaatagtatactcatatttgacgaagctcacaacctggtacgaagatttactaataaattactg |
43963419 |
T |
 |
| Q |
103 |
acaaacgagatttactaataaattactgacaaacgagatttaatgcataaaacattgttctttacagtgtcaacctggcaattatttatttaacattgtc |
202 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43963418 |
acaaacgagatctactaataaattactgacaaacgagatttaatgcataaaacattgttctttacagtgtcaacctggcaattatttaattaacattgtc |
43963319 |
T |
 |
| Q |
203 |
cttttgactactctagtaatgtgttgttgtcttattgatacttattcatga |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43963318 |
cttttgactactctagtaatgtgttgttgtcttattgatacttattcatga |
43963268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University