View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18329_high_16 (Length: 265)
Name: NF18329_high_16
Description: NF18329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18329_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 20 - 255
Target Start/End: Complemental strand, 42910588 - 42910353
Alignment:
| Q |
20 |
aacagaaagctcgaatcctttattacattgtttgtcggggcacatgtcctccataacaggtcttttagctacaacttgcagttgcttttcaattttaata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42910588 |
aacagaaagctcgaatcctttattacattgtttgtcggggcacatgtcctccataacaggtcttttagctacaacttgcagttgcttttcaattttaata |
42910489 |
T |
 |
| Q |
120 |
tcaagctctcttgacggaacatgcaaggtgatcaatattagattatgtattaagaatcttgtaaaattttcatgtgcaatggtttaatgaagatgataca |
219 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42910488 |
tcaagctctcttgatggaacatgcaaggtaatcaatattagattatgtattaagaatcttgtaaaattttcatgtgcaatggtttaatgaagatgataca |
42910389 |
T |
 |
| Q |
220 |
ttaatttgtttatcataataggtttgggatttcatc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42910388 |
ttaatttgtttatcataataggtttgggatttcatc |
42910353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University