View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18329_high_20 (Length: 251)
Name: NF18329_high_20
Description: NF18329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18329_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 10337081 - 10336859
Alignment:
| Q |
19 |
ctggtaacacatcatcacatgtggcatgttttgaatcccatgctattggtggatataacctcatagattcacatagacatgcctttaaaaaattcatatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10337081 |
ctggtaacacatcatcacatgtggcatgttttgaatcccatgctattggtggatataacctcatagattcacatagacatgcctttaaaaaattcatatt |
10336982 |
T |
|
| Q |
119 |
cttcaatgattcataatccaatgtttcattgtttaatttgttttctgactctttcaatatcttgtgctcaatatcagaataatgtgatagtaaccaaaag |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
10336981 |
cttcaatgattcataatccaatgtttcattgtttaatttgttttctgactctttcaatatcttgtgctcaatatctgaataacgtgatagtaaccaaaag |
10336882 |
T |
|
| Q |
219 |
aaccatgtcaatgctgatgatgt |
241 |
Q |
| |
|
|||||||| |||||||||||||| |
|
|
| T |
10336881 |
aaccatgttaatgctgatgatgt |
10336859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University