View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18329_low_14 (Length: 286)
Name: NF18329_low_14
Description: NF18329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18329_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 33842082 - 33841832
Alignment:
| Q |
18 |
gaacccttaagagataggagacttatggtctgtttgggaagacgattttggaggaaagtggagacgataacttgtttttcttttctaaattatacaagta |
117 |
Q |
| |
|
||||| |||||||| || ||||||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||||||| |||||||||||||||| |
|
|
| T |
33842082 |
gaacctttaagagagagaagacttatggtctgtttgggaagacgattttggaggagagtggagaggatgacttgtttttctttactaaattatacaagta |
33841983 |
T |
|
| Q |
118 |
agaaaatgtttttgaaaatcattaagtatgactgaattattacatgatcacatatcatgatattctttcaattttttgaaagacgattgtcttggtcgcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
33841982 |
cgaaaatgtttttgaaaatcattaagtatgactgaattattacatgatcacatatcatgatattctttcaatttttttaaagacgactgtcttggtcgcc |
33841883 |
T |
|
| Q |
218 |
cttatccttagatcggccatgttccatacaaagatcgcacaaatttcacac |
268 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33841882 |
cttatccttagatctgccatgttccatacaaagatcacacaaatttcacac |
33841832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 194
Target Start/End: Complemental strand, 16033031 - 16032978
Alignment:
| Q |
141 |
aagtatgactgaattattacatgatcacatatcatgatattctttcaatttttt |
194 |
Q |
| |
|
|||| ||| |||||| ||| |||| || |||||||||||||||||||||||||| |
|
|
| T |
16033031 |
aagtgtgattgaattgttatatgaccatatatcatgatattctttcaatttttt |
16032978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University