View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18329_low_20 (Length: 262)
Name: NF18329_low_20
Description: NF18329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18329_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 76 - 239
Target Start/End: Original strand, 27244488 - 27244639
Alignment:
| Q |
76 |
cgatctttaatcggattatctagagggaagaaaatcagcgaaattttttcatcttatcttgtttggttttctctaacattttcattaatcgtttttgaga |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
27244488 |
cgatctttaatcggattatctagagggaagaagatcaacgaaattttttcatcttatcttgtttggtttt------------cattaatcgttattgaga |
27244575 |
T |
 |
| Q |
176 |
gtcgtttcccattgttctagtcttttcttcgaaacgtgtacttgtgagcaatcatatttttcgt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27244576 |
gtcgtttcccattgttctagtcttttcttcgaaacgtgtacttgtgagcaatcatctttttcgt |
27244639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 133 - 222
Target Start/End: Original strand, 27282630 - 27282718
Alignment:
| Q |
133 |
cttgtttggttttctctaacattttcattaatcgtttttgagagtcgtttcccattgttctagtc-ttttcttcgaaacgtgtacttgtga |
222 |
Q |
| |
|
||||||||| |||||||||||||||||||| || |||||||||| ||||||||| |||||||| ||||||| ||||||||||||||||| |
|
|
| T |
27282630 |
cttgtttgggtttctctaacattttcattattc--ctttgagagtcttttcccattattctagtctttttctttgaaacgtgtacttgtga |
27282718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University