View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18329_low_29 (Length: 221)
Name: NF18329_low_29
Description: NF18329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18329_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 89 - 219
Target Start/End: Complemental strand, 7008850 - 7008720
Alignment:
| Q |
89 |
ataaaacactatgtagttgtttaagtttgtgagnnnnnnnnagtgatgtttgtgtgattttatagaagatgatgatggaatgagagttagttgcttctac |
188 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7008850 |
ataacacactatgtagttgtttaagtttgtgagttttttttagtgatgtttgtgtgattttatagaagatgatgatggaatgagagttagttgcttctac |
7008751 |
T |
 |
| Q |
189 |
gcaaaatggaaaatgggtgtagagtgtttgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7008750 |
gcaaaatggaaaatgggtgtagagtgtttgt |
7008720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 7008938 - 7008892
Alignment:
| Q |
1 |
tgtcatggtactagcacctttgttggtgcttgttttggaggatgaag |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7008938 |
tgtcatggtactagcacctttgttggtgcttgttttggaggatgaag |
7008892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University