View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18329_low_9 (Length: 340)
Name: NF18329_low_9
Description: NF18329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18329_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 225 - 336
Target Start/End: Complemental strand, 3253639 - 3253529
Alignment:
| Q |
225 |
tttggatttcacaagactagtcgcttcaatcaac-aattgtgcattgcagtcctttgagtcgtt-tttgacttctaatggtaactcatcatcaccgcctt |
322 |
Q |
| |
|
||||||||| |||| ||| |||||||||| || |||||||||||| |||||| |||| || |||||||||||||||||||||||||||||| |||| |
|
|
| T |
3253639 |
tttggattttacaacactcatcgcttcaattcactaattgtgcattg---tcctttaagtctttctttgacttctaatggtaactcatcatcaccacctt |
3253543 |
T |
|
| Q |
323 |
cttttcatctcact |
336 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
3253542 |
cttttcatgtcact |
3253529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 153 - 213
Target Start/End: Complemental strand, 3253686 - 3253626
Alignment:
| Q |
153 |
tataatgaagagacgcgtgtagggatcgatcatcacttggctattgatttggattttacaa |
213 |
Q |
| |
|
||||| |||||||| ||| ||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
3253686 |
tataacgaagagacacgtttagggttctatcatcacttggctattgatttggattttacaa |
3253626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University