View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1832_high_4 (Length: 489)
Name: NF1832_high_4
Description: NF1832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1832_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 303 - 439
Target Start/End: Original strand, 50372621 - 50372757
Alignment:
| Q |
303 |
ccgtatcctctttgttcataatgaacaaattaaaaatggtggtgtccttctttgagatgttaaggaaagcaaactgcactagagtctaagcaagaaagcg |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50372621 |
ccgtatcctctttgttcataatgaacaaattaaaaatggtggtgtccttctttgagatgttaaggaaagcaaactgcactagagtctaagcaagaaagcg |
50372720 |
T |
 |
| Q |
403 |
accgaaaagtatctttctttaggatatatcctcaagg |
439 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50372721 |
accgaaaagtatctttctttaggatatatcctcaagg |
50372757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 50371968 - 50372145
Alignment:
| Q |
1 |
tccttgccacttgagcccaaacaatttggtttaccaatcaattcactttgtttagcacctaaccaatccnnnnnnnnn-agttaaatctacatgtataaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
50371968 |
tccttgccacttgagcccaaacaatttggtttactaatcaattcactttgtttagcacctaatcaatcctttttttttgagttaaatctacatgtataaa |
50372067 |
T |
 |
| Q |
100 |
ctatttattatatactcatagtttatcttttagtggactcgtgcttggtcacgcgtctaataactagtacattaatac |
177 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50372068 |
ccatttattatatactcatagtttatcttttagtggactcgtgcttggtcacgcgtctaataacaagtacattaatac |
50372145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 42861351 - 42861383
Alignment:
| Q |
1 |
tccttgccacttgagcccaaacaatttggttta |
33 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
42861351 |
tccttgccactggagcccaaacaatttggttta |
42861383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University