View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1832_low_13 (Length: 321)
Name: NF1832_low_13
Description: NF1832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1832_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 31520021 - 31520322
Alignment:
| Q |
1 |
tctctacaacaatattgacactcgaataattttctctcattcaaaggctcagatgattctgattgtgttggagattggttcaaacaagcttcttggatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31520021 |
tctctacaacaatattgacactcgtataattttctcccattcaaaggctcagatgattctgattgtgttggagattggttcaaacaagcttcttggatgt |
31520120 |
T |
 |
| Q |
101 |
tgatgccaaaaagctttagggtattggtagaggtgggggtagcaatggaattttcatggtaatcaacatatgccatgagtgatatatgtgtgagatagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31520121 |
tgatgccaaaaagctttagggtattggtagaggtgggggtagcaatggaattttcatggtaatcaacatatgccatgagtgatatatgtgtgagatagaa |
31520220 |
T |
 |
| Q |
201 |
gcaccaaaatannnnnnnnnnnnnnnnnnnnagctacaaaatatgtatgtgaagggtttatatgagagagtagaaatttatgcataagcttgggaaaagg |
300 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31520221 |
gcaccaaaata---tgtgatgtgtgtgtgtgagctacaaaatatgtatgtgaagggtttatatgagagagtagaaatttatgcataagcttgggaaaagg |
31520317 |
T |
 |
| Q |
301 |
gatgt |
305 |
Q |
| |
|
||||| |
|
|
| T |
31520318 |
gatgt |
31520322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University