View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18330_high_10 (Length: 388)
Name: NF18330_high_10
Description: NF18330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18330_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 6e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 148 - 372
Target Start/End: Original strand, 5737215 - 5737438
Alignment:
| Q |
148 |
aaggtccatgacttcacacctctttaaagcaaagtaaaattgatagataaattggttgaaatctcaaatgtccaaaaggcaatattgtacatgcatgatc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| ||||||| ||| |
|
|
| T |
5737215 |
aaggtccatgacttcacacctctttaaagcaaagtaaaattgatagataaattggttgtaatctcaaatgtccaaaag-caatattgtgcatgcatcatc |
5737313 |
T |
|
| Q |
248 |
acaacccacaacaggcaagttgcaagtatacattaacactttggctaaatttcacataaaatggtatgagcttaaaatttggggaccctacgacgcttca |
347 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||| |||| || |||||||||||||||||||| || |||||| |
|
|
| T |
5737314 |
acaacccacaacaggcaagctgcaggtatacattaacactttggctaaatttcacctaaaacggtacgaacttaaaatttggggaccctaggatgcttca |
5737413 |
T |
|
| Q |
348 |
catttggtcattttatttatttatt |
372 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5737414 |
catttggtcattttatttatttatt |
5737438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University