View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18330_high_16 (Length: 314)
Name: NF18330_high_16
Description: NF18330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18330_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 10 - 297
Target Start/End: Original strand, 47080474 - 47080761
Alignment:
| Q |
10 |
agtgagatgaattactagtaaaatttgaatgaaacagaaaagattgaaagatcagaaacaataaatgagagagtggagcaggcatttggaaaactatgtt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47080474 |
agtgaaatgaattactagtaaaatttgaatgaaacagaaaagattgaaagatcagaaacaataaatgagagagtggagcaggcatttggaaaactatgtt |
47080573 |
T |
 |
| Q |
110 |
tgttaggattcaccggcaggacctgagggagcacacagaatgtgtccggagtgcccctgttgtgtcacagactcaaccttcaattaatgtatacttacag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47080574 |
tgttaggattcaccggcaggacctgagggagcacacagaatgtgtccggagtgcccctgttgtgtcacagactcaaccttcaattaatgtatacttacag |
47080673 |
T |
 |
| Q |
210 |
tacatgttagaaagggtattattgggaattgtactcattattgataccttcattccctatcacaattggtctatttcaatctttaatg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47080674 |
tacatgttagaaagggtattattgggaattgtactcattattgatacattcattccctatcacaattggtctatttcaatctttaatg |
47080761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University