View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18330_high_22 (Length: 240)
Name: NF18330_high_22
Description: NF18330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18330_high_22 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 5550458 - 5550235
Alignment:
| Q |
17 |
gttgggaccaaagttaacaaatgctaacatgttaattgttgtattaatattttcttttagatcaggaatcgaaatcgggaccttttaactccttaactac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5550458 |
gttgggaccaaagttaacaaatgctaacatgttaattgttgtattaatattttcttttagatcaggaatcgaagtcgggaccttttaactccttaactac |
5550359 |
T |
 |
| Q |
117 |
tttaaacccttagctcaaccaaatgagttaactcnnnnnnnaagtctaactaattcaaatcaactttctgttttagaatgattgctttaaggattgaaga |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5550358 |
tttaaacccttggctcaaccaaatgagttaactctttttttaagtctaactaattcaaatcaactttctgttttagaatgattgctttaaggattgaaga |
5550259 |
T |
 |
| Q |
217 |
aatgcttgaaaattaaaaattacc |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5550258 |
aatgcttgaaaattaaaaattacc |
5550235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 100 - 143
Target Start/End: Complemental strand, 39162222 - 39162179
Alignment:
| Q |
100 |
tttaactccttaactactttaaacccttagctcaaccaaatgag |
143 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
39162222 |
tttaactccttatctactttagtcccttagctcaaccaaatgag |
39162179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 98 - 134
Target Start/End: Original strand, 39989378 - 39989414
Alignment:
| Q |
98 |
cttttaactccttaactactttaaacccttagctcaa |
134 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
39989378 |
cttttaactccttaactactttaatcccttaactcaa |
39989414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University