View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18330_low_21 (Length: 250)
Name: NF18330_low_21
Description: NF18330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18330_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 119 - 238
Target Start/End: Complemental strand, 5550117 - 5549998
Alignment:
| Q |
119 |
cctatcctctctcattttacagagcttttgtgttaatccgataaattctgcagtgatgaaattccaccaaaattatgtagcaatgttaataaaatttccc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5550117 |
cctatcctctctcattttacagagcttttgtgttaatccaataaattctgcactgatgaaattccaccaaaattatgtagcaatgttaataaaatttccc |
5550018 |
T |
 |
| Q |
219 |
aactgaggtcagcatgttct |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
5550017 |
aactgaggtcagcatgttct |
5549998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University