View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18330_low_27 (Length: 223)
Name: NF18330_low_27
Description: NF18330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18330_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 10 - 207
Target Start/End: Complemental strand, 9424486 - 9424289
Alignment:
| Q |
10 |
agagagaagaaaaacaatagttagcttgagaggaaagtataatataaccataaggagattgggagataaatgaacttacaatatcaccattagaaattcc |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9424486 |
agagagaacaaaaacaatagttagcttgagaggaaagtataatataaccataaggagattgggagataaatgaacttacaatatcaccattagaaattcc |
9424387 |
T |
|
| Q |
110 |
taagttgaccaaagcagaagcaagcttgagacatctttcataggtttctctccaagaaaatctaacatgatcattgtagatgatggaaactttgtcac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9424386 |
taagttgaccaaagcagaagcaagcttgagacatctttcataggtttctctccaagaaaatctaacatgatcattgtagatgatggaaactttgtcac |
9424289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University