View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18330_low_29 (Length: 205)
Name: NF18330_low_29
Description: NF18330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18330_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 22 - 195
Target Start/End: Original strand, 40790413 - 40790580
Alignment:
| Q |
22 |
agttactaatgatatgttcaaactatgtgagctcgattttaatagcaagtaaaaattgactatactcatctctaataatgcatacacccaaatacctaca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40790413 |
agttactaatgatatgttcaaactatgtgagctcgattttaatagcaagtaaaaattgactatactcatctctaataatgcatacaccc-aatacctaca |
40790511 |
T |
|
| Q |
122 |
ttattacgatgagaagattaaaagaagtatcgtatcaatgtttcacttctacatgctaacaacttcttctctct |
195 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| ||| ||||| |
|
|
| T |
40790512 |
ttattacgatgagaagattaaaagaa-----gtatcaatgttttacttctacatgctaacaactgcttttctct |
40790580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University