View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18330_low_9 (Length: 466)
Name: NF18330_low_9
Description: NF18330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18330_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-113
Query Start/End: Original strand, 18 - 314
Target Start/End: Complemental strand, 37996031 - 37995728
Alignment:
| Q |
18 |
gaaacttcagggctcaacctcaaatcatcatcagctctctcacacaaacaaacatttagaggtaaccccctta----------------acaatttcata |
101 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
37996031 |
gaaacttcagggctcaacctcaaatcataatcagctctctcacacaaacaaccatttagaggtaacccccttattgctgtgatcataaaacaatttcata |
37995932 |
T |
 |
| Q |
102 |
atactaaatccactcactttgcagcttttacaaaccaaaccaaaccaaaatggcttctccaccagacacaagcaaaaccataaagcttgaacgttacaac |
201 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37995931 |
atcctaaatccactcactttgcagcttttta---------caaaccaaaatggcttctccaccagacacaagcaaaaccataaagcttgaacgttacaac |
37995841 |
T |
 |
| Q |
202 |
agctacatcagaaaagttaacagcactaaactccttaacgcttcttccaaacttctcttccgtgccacacttttaatagcacttgttcttgttttcttct |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37995840 |
agctacatcagaaaagttaacagcactaaactccttaacgcttcttccaaacttctcttccgtgccacacttttaatagcacttgttcttgttttcttct |
37995741 |
T |
 |
| Q |
302 |
tcaccttcaatta |
314 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37995740 |
tcaccttcaatta |
37995728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 376 - 461
Target Start/End: Complemental strand, 37995666 - 37995581
Alignment:
| Q |
376 |
gcattcggcggtggtggagcatgggaaagacatgtccgtcactccgccattccccgtcgtcctaatggtttcaccgttcttctcac |
461 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37995666 |
gcattcggcggtggtggagcatgggaaagacatgtccgtcactccgccattccccgtcgtcctaatggtttcaccgttcttgtcac |
37995581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University