View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_high_25 (Length: 286)
Name: NF18331_high_25
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 277
Target Start/End: Complemental strand, 7086894 - 7086635
Alignment:
| Q |
18 |
cgaaggagatggtagatgatgctcannnnnnnnctctggggccaaaggcgatggtgggtgatgctgagaagctggctcaattttagaaactcggggtgat |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7086894 |
cgaaggagatggtagatgatgctcattttttttctctggggccaaaggcgatggtgggtgatgctgagaagctggctcaattttagaaactcggggtgat |
7086795 |
T |
 |
| Q |
118 |
gtaggatgagtgctttcttccacagatgaagaatttggctttggcaccttcatggtgtcatgatgagagggagactgaggttgagttgaggcaacatgaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7086794 |
gtaggatgagtgctttcttccacagatgaagaatttggctttggcaccttcatggtgtcatgatgagagggagactgaggttgagttgaggcaacatgaa |
7086695 |
T |
 |
| Q |
218 |
cctgagatgccgcatgagatgatggtggtggagagttgacatggtttggcgatgatgatg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7086694 |
cctgagatgccgcatgagatgatggtggtggagagttgacatggtttggcgatgttgatg |
7086635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University