View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_high_29 (Length: 263)
Name: NF18331_high_29
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 7 - 253
Target Start/End: Original strand, 44065274 - 44065519
Alignment:
| Q |
7 |
ctcgacactctctctaactccatgccatattcataattaattaatcaactaactcatgtagattgtatttacgtaaacaacaaaccaaaaagagtcgaca |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44065274 |
ctcgacactctctctaacttcatgccatattcataattaattaatcaactaactcatgtagattgtatttacgtaaacaacaaaccaaaaagagtcgaca |
44065373 |
T |
 |
| Q |
107 |
agttttggcttaatatagattgataagccaccattaacgattcaataaccgataaagtttaatgtgctctccctcgtcatgaagtagttggcaggtcact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44065374 |
agttttggcttaatatagattgataagccaccattaacgattcaataaccgataaagtttaatgtgctctccctcgtcatgaagtagttggcaggtcact |
44065473 |
T |
 |
| Q |
207 |
tttagccggcactttgtacaataatgtatttttctttgctttttctt |
253 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44065474 |
tttagccggcac-ttgtacaataatgtatttttctttgctttttctt |
44065519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University