View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_high_31 (Length: 250)
Name: NF18331_high_31
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 43357240 - 43357165
Alignment:
| Q |
1 |
cttgagtgggacactgccatcaatttattctaatcaattcaggagaacacatatgcttgcatgaatctggttcttt |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43357240 |
cttgagtgggacactgccatcaatttattctaatcaattcaggagaacacatatgcttgcatgaatctggttcttt |
43357165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 158 - 224
Target Start/End: Complemental strand, 43357083 - 43357017
Alignment:
| Q |
158 |
cccgaccctcgttatcagcctaaggattttttgatcaaattttatcgcatatttatgtagtgtagtg |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43357083 |
cccgaccctcgttatcagcctaaggattttttgatcaaattttatcgcatatttatgtagtgtagtg |
43357017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University