View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_high_34 (Length: 248)
Name: NF18331_high_34
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_high_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 70 - 230
Target Start/End: Original strand, 32769106 - 32769266
Alignment:
| Q |
70 |
gaaaattttgtttgtgattatgtcttttggtttgtatagcaatgatattttccgtaaccaaaggtcaatattataccagcttatatgttacatacgaatt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32769106 |
gaaaattttgtttgtgattatgtcttttggtttgtatagcaatgatattttccgtaaccaaaggtcaatattataccagcttatatgttacatacgaatt |
32769205 |
T |
|
| Q |
170 |
aaaagtttttacaatttgaaccataaactaacttcaagtaaatagtcacatatcatatcat |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32769206 |
aaaagtttttacaatttgaaccataaactaacttcaagtaaatagtcacatatcatatcat |
32769266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University