View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_high_4 (Length: 593)
Name: NF18331_high_4
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 341; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 7 - 363
Target Start/End: Original strand, 54659761 - 54660117
Alignment:
| Q |
7 |
attctttacgttcttctcgctggatttttaccgtttcaggatgataatttggttgctatgtataagaagatttaccgcggtgatttcaaatgtccaccgt |
106 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54659761 |
attctttacgttcttctggctggatttttaccgtttcaggatgataatttggttgctatgtataagaagatttaccgcggtgatttcaaatgtccaccgt |
54659860 |
T |
|
| Q |
107 |
ggttttctttggaagctaggaggttaattacaaagcttctagatccgaatccgaatacaagaatttcaatatcgaagataatggattcttgttggtttaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |||||||||| |
|
|
| T |
54659861 |
ggttttctttggaagctaggaggttaattacaaagcttctagatccgaatccgaatacaagaatatccatatcgaagataatggattctagttggtttaa |
54659960 |
T |
|
| Q |
207 |
gaaaccggttccaaagagtatagcgatgaggaagaaggagaaagaagaggaagaagataaggtgtttgaatttatggagtgtgagaaatcatcgacgaca |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54659961 |
gaaaccggttccaaagagtatagcgatgaggaagaaggagaaagaagaggaagaagataaggtgtttgaatttatggagtgtgagaaatcatcgacgaca |
54660060 |
T |
|
| Q |
307 |
atgaatgcttttcatataatttcactatcagaaggatttgatttgtctccgttgttt |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54660061 |
atgaatgcttttcatataatttcactatcagaaggatttgatttgtctccgttgttt |
54660117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 175; E-Value: 6e-94
Query Start/End: Original strand, 400 - 574
Target Start/End: Original strand, 54660154 - 54660328
Alignment:
| Q |
400 |
tttgcaacgggtgggacgccgagtagagtgatatcgaaactggaacaagtggcgaaggcggtgaaatttgatgtgaagagtagtgatacgaaggtgagac |
499 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54660154 |
tttgcaacgggtgggacgccgagtagagtgatatcgaaactggaacaagtggcgaaggcggtgaaatttgatgtgaagagtagtgatacgaaggtgagac |
54660253 |
T |
|
| Q |
500 |
ttcaagggcaagaaagagggaggaaaggaaagttggctattgcagcggatatttacgcggtgacaccgtcgtttc |
574 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54660254 |
ttcaagggcaagaaagagggaggaaaggaaagttggctattgcagcggatatttacgcggtgacaccgtcgtttc |
54660328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University