View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_high_40 (Length: 225)
Name: NF18331_high_40
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_high_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 12 - 173
Target Start/End: Original strand, 7494680 - 7494841
Alignment:
| Q |
12 |
agcacagaaccgactattattcatcgatcccaaaactcttcttttgacacagtctgaaagagtgagtataatttgtctatttgttgctttttcttattta |
111 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||| ||| |
|
|
| T |
7494680 |
agcacaaaaccgactattattcattgatcccaaaactcttcttttgacacagactgaaagagtgagtgtaatttgtctatttattgctttttcttactta |
7494779 |
T |
 |
| Q |
112 |
gttggacagattcttgttgtcttggcttattatgttagttgattaatttaagtatcttgttt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7494780 |
gttggacagattcttgttgtcttggcttattatgttagttgattaatttaagtatcttgttt |
7494841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University