View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_high_42 (Length: 207)
Name: NF18331_high_42
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_high_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 7e-45; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 18 - 109
Target Start/End: Original strand, 37461800 - 37461891
Alignment:
| Q |
18 |
gtttctgcatccagacattgttgcatcatatgagtatattttcatgtgggatgaagacctcggggttgagaattttaacgcagaagagtgag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37461800 |
gtttctgcatccagacattgttgcatcatatgagtatattttcatgtgggatgaagacctcggggttgagaattttaacgcagaagagtgag |
37461891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 18 - 109
Target Start/End: Original strand, 37455847 - 37455938
Alignment:
| Q |
18 |
gtttctgcatccagacattgttgcatcatatgagtatattttcatgtgggatgaagacctcggggttgagaattttaacgcagaagagtgag |
109 |
Q |
| |
|
|||||||||||| |||||||| ||| | ||||| |||||||| || ||||||||||| || || |||||| ||||||| ||||| ||||||| |
|
|
| T |
37455847 |
gtttctgcatcctgacattgtggcaccttatgactatatttttatatgggatgaagatctgggtgttgagcattttaatgcagaggagtgag |
37455938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 95
Target Start/End: Complemental strand, 8580181 - 8580107
Alignment:
| Q |
18 |
gtttctgcatccagacattgttgcatcatatgagtatattttcatgtgggatgaagacctcggggttgagaattttaa |
95 |
Q |
| |
|
||||||||||||||||| ||| ||| ||||||| |||| |||||||||||||||||||| ||||||| | ||||||| |
|
|
| T |
8580181 |
gtttctgcatccagacactgtggcaccatatgactata--ttcatgtgggatgaagacct-ggggttgggcattttaa |
8580107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 39262598 - 39262688
Alignment:
| Q |
19 |
tttctgcatccagacattgttgcatcatatgagtatattttcatgtgggatgaagacctcggggttgagaattttaacgcagaagagtgag |
109 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||| ||||| || || |||||||||||| | || |||||| ||||||| || |||||||||| |
|
|
| T |
39262598 |
tttctgcatcctgacattgtggcaccatatgactatatatttatatgggatgaagacttgggcgttgagcattttaatgccgaagagtgag |
39262688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University