View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_high_6 (Length: 544)
Name: NF18331_high_6
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 7e-41; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 439 - 528
Target Start/End: Complemental strand, 16543808 - 16543719
Alignment:
| Q |
439 |
cacaagagtctgacatctcaaatctttatggtatccatctcactttactacttgcagcttttctatttatttattttaggcagtgtttat |
528 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16543808 |
cacaagagtctgacatctcaaatctttatggtatccatctcactttactgcttgcagcttttctatttatttattttaggcagtgtttat |
16543719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 10 - 112
Target Start/End: Complemental strand, 16547233 - 16547131
Alignment:
| Q |
10 |
attattcttagtctcgtttacttttgaggcaccctgaacatcatgcaactcgtgaagcttttttagtcttgaagcaaagtcttcattgcttgtgcttgtg |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||| |||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16547233 |
attattcttagtctcttttacttttgaggcaccttgaatatcatgcagctcgcgaagcttttttattcttgaagcaaagtcttcattgcttgtgcttgtg |
16547134 |
T |
 |
| Q |
110 |
ttg |
112 |
Q |
| |
|
||| |
|
|
| T |
16547133 |
ttg |
16547131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 169 - 275
Target Start/End: Complemental strand, 16547138 - 16547024
Alignment:
| Q |
169 |
ttgtgttgtgatttgacacaaagttctagggtatgtatacacacaagtgatatactaaactttcgtaa--------caaaccaaacaaatgggataaact |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
16547138 |
ttgtgttgtgatttgacacaaagttctagggtatatatacacacaagtgatatactaaactttcgtaacaaagtaacaaaccaaacaaatgggatcaact |
16547039 |
T |
 |
| Q |
261 |
tctaaattaaattgt |
275 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
16547038 |
tctaaattaaattgt |
16547024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 268 - 358
Target Start/End: Complemental strand, 16543993 - 16543891
Alignment:
| Q |
268 |
taaattgtattgttaatttgaacttttaatataataagattatagtcccacacaa------------atcgtaacaaaattctatgtttttgttaaggcg |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
16543993 |
taaattgtattgttaatttgaacttttaatataataagattatagtcccacacaagtgatatacactatcgtaacaaaattctatttttttgttaaggcg |
16543894 |
T |
 |
| Q |
356 |
taa |
358 |
Q |
| |
|
||| |
|
|
| T |
16543893 |
taa |
16543891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University