View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_low_12 (Length: 376)
Name: NF18331_low_12
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 8793093 - 8792884
Alignment:
| Q |
19 |
tatgcagtaggacatacaaaacaaattgaggccaaaacttcagccaattttttatgcaattttcaatctaattccctgcaaacaatccttgtcaaactga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8793093 |
tatgcagtaggacatacaaaacaaattgaggccaaaacttcagccaatttttgatgcaattttcaatctaattccctgcaaacaatccttgtcaaactga |
8792994 |
T |
 |
| Q |
119 |
ccaaatcaacttccctacatcaaaaggaactaatgcagtcccttgcgattgcaatggcttatgcaacacgattctttgagaaggaatggtgaagcaaaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8792993 |
ccaaatcaacttccctacatcaaaaggaactaatgcagtcccttgcgattgcaatggcttatgcaacacgattctttgagaaggaatggtgaagcaaaag |
8792894 |
T |
 |
| Q |
219 |
gtcttctctg |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
8792893 |
gtcttctctg |
8792884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University