View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_low_20 (Length: 305)
Name: NF18331_low_20
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 38775302 - 38775592
Alignment:
| Q |
1 |
attggttagggcttagttgactcatacttcacaagggtgtgagcccaactcaaggtaagaatctctttaatcaataaatgatgatatgcaaacacggccn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |||| || |
|
|
| T |
38775302 |
attggttagggcttagttgactcatacttcacaagggtgtgagcccaactcaaggtaagaatctctttaattaataaatgatgatatgtaagcacgtcct |
38775401 |
T |
|
| Q |
101 |
nnnnnn-atggtggagaaagcttacaccgattgaaaatatatctttcagtgatccatgagtcttgaaattcggatgagccctcgtaatctaattcaaatg |
199 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38775402 |
tttttttatggcggagaaagcttacaccgattgaaaatatatctttcagcgatccatgagttttgaaattcggatgagccctcgtaatctaattcaaatg |
38775501 |
T |
|
| Q |
200 |
acttattttatataaaacttttgcaagtttgtttccatcattattcaaataatttacggtagtagatcaaacgaaatatgacgagacttgt |
290 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38775502 |
acttattttatataaaatttttgcaagtttgtttccatcattattcaaataatttacggtagtagatcaaacgaaatatgacgagacttgt |
38775592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University