View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_low_28 (Length: 274)
Name: NF18331_low_28
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_low_28 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 21 - 274
Target Start/End: Complemental strand, 27548353 - 27548100
Alignment:
| Q |
21 |
tctcatacgaattgatccaagaattaaacctaggaccggccacgtgcttaagagaacccatccccttgtacttgcacagatacatgtcagtacactccca |
120 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||| ||| |||||||||||| || ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27548353 |
tctcatacgcaatgatccaagaattaaacctaggaccgaccatgtgcttaagagatccgatccccttgtacttgcacaaatacatgtcagtacactccca |
27548254 |
T |
 |
| Q |
121 |
gttccttttatattcataaaatccccacttcaaacaaggaaaggatctctgatattcaaaattcatagttcatcactcaatgacctctacaactgtatta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27548253 |
gttccttttatattcataaaatccccacttcaaacaaggaaaggatctctgatattcaaaattcatagttcatcactcaatgacctctacaactgtatta |
27548154 |
T |
 |
| Q |
221 |
acattttggatcaaaatatcaatgtctcactgttggatatcttgaatagcatcc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27548153 |
acattttggatcaaaatatcaatgtctcactgttggatatcttgaatagcatcc |
27548100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 36 - 75
Target Start/End: Complemental strand, 27548452 - 27548413
Alignment:
| Q |
36 |
tccaagaattaaacctaggaccggccacgtgcttaagaga |
75 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
27548452 |
tccaagaattaaacctaggaccgaccatgtgcttaagaga |
27548413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University