View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_low_31 (Length: 251)
Name: NF18331_low_31
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 22 - 236
Target Start/End: Complemental strand, 29415630 - 29415416
Alignment:
| Q |
22 |
tgtgtgtgtcagatccttgtgagaaaacacaatagatacaacattttgctaatccttatgatggagtgtgccagatctttaggcttgttgtgatcgaaac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29415630 |
tgtgtgtgtcagatccttgtgagaaaacacaatagatacaacattttgctaatccttatgatggagtgtgccagatctttaggcttgttgtgatcgaaac |
29415531 |
T |
|
| Q |
122 |
taattgaccaaagtaggagtggaattatttcaaataaacaattgaaagagtttaacattttatactgaattaatcttccaaagtccaatacaaggaatta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||| | |
|
|
| T |
29415530 |
taattgaccaaagtaggagtggaattatgtcaaataaacaattgaaagagtttaacattttatactgaattaatattccaagtcccaacacaaggaatca |
29415431 |
T |
|
| Q |
222 |
gcatcccctcctttg |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29415430 |
tcatcccctcctttg |
29415416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University