View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_low_37 (Length: 242)
Name: NF18331_low_37
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_low_37 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 68 - 242
Target Start/End: Original strand, 37179403 - 37179577
Alignment:
| Q |
68 |
ctaagtctcaaagaacccgacggttgttttacaacaagcaagatctccgtcgtcggtggtggcggcggcaatttcaaactgaagcggttaatttttgatc |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
37179403 |
ctaagtctcaaagaacccgacggttgttttacaacaagcaagacctccgctgccggtggtggtggcggtgatttagaactgaagcggttaatttttgatc |
37179502 |
T |
|
| Q |
168 |
cttcacgtttgctttcaagaaagcacacggtgttttgagatgttctgttctggcaacgtttctggatttacaatt |
242 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37179503 |
cttcacgtttgctttcaaggaagcacatggtgttttgaaatgttctgttctggcaacgtttctggatttacaatt |
37179577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University