View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_low_38 (Length: 241)
Name: NF18331_low_38
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 4 - 223
Target Start/End: Complemental strand, 27547734 - 27547515
Alignment:
| Q |
4 |
aattgcaaaatcaaacacgaaacaagataattaaacttattcaaacattgatgtattataaagcaaatcgaacacatcggaatgaaaatagatcgnnnnn |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27547734 |
aattgcaaaatcaaacacgaaacaagataattaaacttattcaaacattgatgtattataaagcaaatcgaacacatcggaatgaaaatagatcgaaaaa |
27547635 |
T |
|
| Q |
104 |
nnttgcgattcagtaccaattgcagattgaaaaacgaaagaagagaaatcggaaaggaagagattcggggaaaaagcaacaaaccctagaactgctccaa |
203 |
Q |
| |
|
||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27547634 |
cattgtgattcagtagcaattgcagattgaaaaacgaaagaagagaaatcggaaaggaagagattcggggaaaaagtaacaaaccctagaactgctccaa |
27547535 |
T |
|
| Q |
204 |
tacttcttgtcccaaggtcc |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27547534 |
tacttcttgtcccaaggtcc |
27547515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University