View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_low_42 (Length: 215)
Name: NF18331_low_42
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 7353058 - 7353267
Alignment:
| Q |
1 |
cttatgaagaagttggttcatgaaatgatgcataaacaagaaacacattttcaggtaaacttatattaatata--nnnnnnnnctggtaagattgtgatt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
7353058 |
cttatgaagaagttggttcatgaaatgatgcataaacaagaaacacattttcaggtaaacttatattaatatattttttttttctggtaaaattgtgatt |
7353157 |
T |
 |
| Q |
99 |
agaaaaacatatgtgtccaaagatatgtggtagtatttta-nnnnnnnatgttaaaagtatactatttttagtcagtatataccaactttgttgcaatgt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
7353158 |
agaaaaacatatgtgtccaaagatatgtgggagtattttattttttttattttaaaagtatactatttttagtcagtatatatcaactttgttacaatgt |
7353257 |
T |
 |
| Q |
198 |
gagatttgtt |
207 |
Q |
| |
|
|||||||||| |
|
|
| T |
7353258 |
gagatttgtt |
7353267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University