View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18331_low_9 (Length: 425)
Name: NF18331_low_9
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18331_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 178 - 417
Target Start/End: Complemental strand, 9036901 - 9036660
Alignment:
| Q |
178 |
tcatttatataattggccgatcggttttgatttgagatcgggagttagtgtctaattcataaaatttgggcttactttggtgttttctccggtagaccgg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9036901 |
tcatttatataattggccgatcggttttgatttgagatcgggagttagtgtctagttcaaaaaatttgggcttactttggtgttttctccggtagaccgg |
9036802 |
T |
|
| Q |
278 |
tggttgagggnnnnnnn--aatgatttgtttatgaagttaggtgggtcgatcacttttgtttttgaagtctagtacaaaaaattatttatataactggcc |
375 |
Q |
| |
|
| ||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
9036801 |
tagttgaggttttttttttaatgatttgtttatgaagttaggtgggtcgatcgcttttgtttttgaagtctagttcaaaaaatcatttatataactggcc |
9036702 |
T |
|
| Q |
376 |
tattgcttttgtttctcaagtttttgtgctcgtgatgatgtc |
417 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9036701 |
tatcgcttttgtttctcaagtttttgtgctcgttatgatgtc |
9036660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 18 - 159
Target Start/End: Complemental strand, 9037027 - 9036888
Alignment:
| Q |
18 |
ggtttatcattcaatatcactaaaatatactcgtgtcatctactgagggctatgcctatgggtattggttttagatagatagacattgtttcgattccta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9037027 |
ggtttatcattcaatatcactaaaatatactcgtgtcatctactgagggctatgcctatgggtattggttttagatagatagacattgtttcgattccta |
9036928 |
T |
|
| Q |
118 |
caaagaataaaatctaatagttataatatcatttatataatt |
159 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9036927 |
caaaga--aaaatctaatagttataatatcatttatataatt |
9036888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University