View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18332_high_14 (Length: 263)
Name: NF18332_high_14
Description: NF18332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18332_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 43 - 145
Target Start/End: Original strand, 42121392 - 42121494
Alignment:
| Q |
43 |
aaaatcagtttgattggtgaactttcatagcaaacaggtaaagccagagacacaccaaataacctctgaaagaagagtcaatattcacaaaagattgtat |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
42121392 |
aaaatcagtttgattggtgaactttcatagtaaacaggtaaagccacggacataccaaataacctctgaaagaatattgaatattcacaaaagattgtat |
42121491 |
T |
 |
| Q |
143 |
att |
145 |
Q |
| |
|
||| |
|
|
| T |
42121492 |
att |
42121494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 165 - 263
Target Start/End: Original strand, 42121594 - 42121692
Alignment:
| Q |
165 |
ttacagtcttgttattatgattgtaacattataaagattcgttggtgcttccacccagcagcatatcacgattccacattgctacctctttgtactaca |
263 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||||||||| ||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
42121594 |
ttacagtcttgttattatgatggtaacattataaagattcattggtgcttccatgcagcagcatatcacgattccaaattgctgcctctttgtactaca |
42121692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University