View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18332_low_8 (Length: 429)
Name: NF18332_low_8
Description: NF18332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18332_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 2e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 326 - 417
Target Start/End: Complemental strand, 13490894 - 13490803
Alignment:
| Q |
326 |
ggatgttgttattttaattgaaaccttagttgaaagtaataaaatttctgatttatgttatacaattgggttcgataatcacttctctgttg |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13490894 |
ggatgttgttattttaattgaaaccttagttgaaagtaataaaatttctgatttatgttatacaattgggttcgataatcacttctctgttg |
13490803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 19775305 - 19775240
Alignment:
| Q |
1 |
actaaacttgaatgcatgtgattggaaagaaa--aaaagaaaatt-acattatagtcacaatttac |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||| ||||||||||| |||||||| |
|
|
| T |
19775305 |
actaaacttgaatgcatgtgattggaaagaaaagaaaaaaaaattaacattatagtcgcaatttac |
19775240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 415
Target Start/End: Complemental strand, 12354653 - 12354574
Alignment:
| Q |
336 |
attttaattgaaaccttagttgaaagtaataaaatttctgatttatgttatacaattgggttcgataatcacttctctgt |
415 |
Q |
| |
|
|||||||||||||| || ||||| |||| |||||||||||| | ||||||| |||||| || || |||||||||||||| |
|
|
| T |
12354653 |
attttaattgaaactttggttgacagtagcaaaatttctgatctctgttataaaattggttttgaaaatcacttctctgt |
12354574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 212 - 249
Target Start/End: Complemental strand, 28696833 - 28696796
Alignment:
| Q |
212 |
ttaaaaagtgtgtgatttagccactaggctattgaacc |
249 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
28696833 |
ttaaaaagtgtgtgatcttgccactaggctattgaacc |
28696796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 415
Target Start/End: Original strand, 23147433 - 23147512
Alignment:
| Q |
336 |
attttaattgaaaccttagttgaaagtaataaaatttctgatttatgttatacaattgggttcgataatcacttctctgt |
415 |
Q |
| |
|
|||||||||||||| || ||||| |||| |||||||||||| | ||||||| |||||| || || |||||||||||||| |
|
|
| T |
23147433 |
attttaattgaaactttggttgacagtagcaaaatttctgatctctgttataaaattggttttgaaaatcacttctctgt |
23147512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 44294299 - 44294257
Alignment:
| Q |
206 |
cacactttaaaaagtgtgtgatttagccactaggctattgaac |
248 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44294299 |
cacaccttaaaaagtgtgtgatctagccactaggctattgaac |
44294257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University