View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18334_high_10 (Length: 235)
Name: NF18334_high_10
Description: NF18334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18334_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 83 - 221
Target Start/End: Original strand, 48317257 - 48317395
Alignment:
| Q |
83 |
gtttttggcaaattaacgtaaacatacttacaagaatcttaatgacttcaacttgccaaatgactttgggattttcccctccaacttgttataatacaaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48317257 |
gtttttggcaaattaacgtaaacatacttacaagaatcttaatgacttcaacttgccaaatgactttgggattttcccctccaacttgttataatacaaa |
48317356 |
T |
|
| Q |
183 |
tccatgctaataagttctttcaattttccaagttcctta |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48317357 |
tccatgctaataagttctttcaattttccaagttcctta |
48317395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 7 - 56
Target Start/End: Original strand, 48317181 - 48317230
Alignment:
| Q |
7 |
attaattcaaatcagtgaatgaatccggaacaaatttatagctaaagttg |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48317181 |
attaattcaaatcagtgaatgaatccggaacaaatttatagctaaagttg |
48317230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University