View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18334_high_12 (Length: 226)
Name: NF18334_high_12
Description: NF18334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18334_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 210
Target Start/End: Complemental strand, 27292362 - 27292168
Alignment:
| Q |
16 |
cagtaattgcaatggtactctccttatttactccaaatctcaattttttgtgcacaaagccttcaacagctgcaaattatttgctaacattaacacaggt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27292362 |
cagtaattgcaatggtactctccttatttactccaaatctcaattttttgtgcacaaagccttcaacagctgcaaattatttgctaacattaacacaggt |
27292263 |
T |
 |
| Q |
116 |
tgcagggtatgctgttggaggagggcatatattgcatatggtttgtgatctaaccattgcagcagataatgctatctttggccaaaccggtccta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27292262 |
tgcagggtatgctgttggaggagggcatatattgcatatggtttgtgatctaaccattgcagcagataatgctatctttggccaaaccggtccta |
27292168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 51 - 210
Target Start/End: Complemental strand, 26162984 - 26162823
Alignment:
| Q |
51 |
aatctcaattttttgtgcacaaagccttcaa--cagctgcaaattatttgctaacattaacacaggttgcagggtatgctgttggaggagggcatatatt |
148 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||| | |||||||||||| ||||||| ||||||||||| |
|
|
| T |
26162984 |
aatctcacttttttgtgcacaaagccttcacagcagctgcaaattatttgctaacattaaaacagatagcagggtatgctattggaggggggcatatatt |
26162885 |
T |
 |
| Q |
149 |
gcatatggtttgtgatctaaccattgcagcagataatgctatctttggccaaaccggtccta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||| |
|
|
| T |
26162884 |
gcatatggtttgtgatctaaccattgcagcagataatgctacctctggccaaactggtccta |
26162823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University