View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18334_high_8 (Length: 250)
Name: NF18334_high_8
Description: NF18334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18334_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 48316990 - 48316825
Alignment:
| Q |
1 |
tgcagtgatgtttctaataatgacctttgtggaacaataccagtagatggcaactttggatccttcccaataaaaaggtacaacaactttgcctttgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48316990 |
tgcagtgatgtttctaataatgacctttgtggaacaataccagtagatggcaactttggatccttcccaataaaaaggtacaacaactttgcctttgaat |
48316891 |
T |
|
| Q |
101 |
gcataacaaatgtactcgtatgatgacacaaatattcatatatattgaaactatagcaatttaaat |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48316890 |
gcataacaaatgtactcgtatgatgacacaaatattcataaatattgaaactatagcaatttaaat |
48316825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 193 - 236
Target Start/End: Complemental strand, 48316823 - 48316781
Alignment:
| Q |
193 |
caaattgtccttttccttttttcagttttgaaaataacggactc |
236 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
48316823 |
caaattgtccttttccttttt-cagttttgaaaataacagactc |
48316781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 251335 - 251403
Alignment:
| Q |
1 |
tgcagtgatgtttctaataatgacctttgtggaacaataccagtagatggcaactttggatccttccca |
69 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
251335 |
tgcagtgatgtttccaataatgacctctgtggaacaataccagtagatggcaactttggatctttccca |
251403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University