View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18334_low_7 (Length: 266)
Name: NF18334_low_7
Description: NF18334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18334_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 11 - 211
Target Start/End: Complemental strand, 45111065 - 45110864
Alignment:
| Q |
11 |
cagagagtgcatgaatgagtgatttttgtttttcactgatcatttactgatgtatcta-tgtgctagtaatttgaaatcaacggcagttatattaaccac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
45111065 |
cagagagtgcatgaatgagtgatttttgtttttcactgatcatttactgatgcatctaatgtgcaagtaatttgaaatcaacggcagttatattagccac |
45110966 |
T |
 |
| Q |
110 |
gtgtcaccaaagacaaaagttaggacacgtgtcatccattctctgttactgattctctgatgccctatgcatgaatgacgagccacggtttcatttgaca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45110965 |
gtgtcaccaaagacaaaagttaggacacgtgtcatccattctctgttactgattctctaatgccctatgcatgaatgacgagccacggtttcatttgaca |
45110866 |
T |
 |
| Q |
210 |
at |
211 |
Q |
| |
|
|| |
|
|
| T |
45110865 |
at |
45110864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University