View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18335_high_11 (Length: 407)
Name: NF18335_high_11
Description: NF18335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18335_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 18 - 394
Target Start/End: Complemental strand, 36423050 - 36422674
Alignment:
| Q |
18 |
ctaagatcaacagtgagagtgtgagtgacacgtttatcaagtgcaaccacagaggctttcctaggaagtaatggttgaccatttttccatttgaggacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36423050 |
ctaagatcaacagtgagagtgtgagtgacacgtttatcaagtgcaaccacagaggctttcctaggaagtaatggttgaccatttttccatttgaggacaa |
36422951 |
T |
 |
| Q |
118 |
gttctttgtctggttcttctagaacaatggaattgagagtgtaactgtttgaggacttaaaaagagggtgtgtcgagaggatcgcacgaactttgttgaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36422950 |
gttctttgtctggttcttctagaacaatggaattgagagtgtaactgtttgaggacttaaaaagagggtgtgtcgagaggatcgcacgaactttgttgaa |
36422851 |
T |
 |
| Q |
218 |
ttcttggatggttagagggtctaaagggtggcgaggttcatcggattcatggtttggttgttgatggcgagtggagaaggatggtttgtggattggattt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36422850 |
ttcttggatggttagagggtctaaagggtggcgaggttcatcggattcatggtttggttgttgacggcgagtggagaaggatggtttgtggattggattt |
36422751 |
T |
 |
| Q |
318 |
gaagattgaaaacggttctttgaggtgcaccatccagagaagatgttgcagtctagagcttctttgttgaatgatga |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36422750 |
gaagattgaaaacggttctttgaggtgcaccatccagagaagatgttgcagtctagagcttctttgttgaatgatga |
36422674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University