View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18335_high_20 (Length: 266)

Name: NF18335_high_20
Description: NF18335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18335_high_20
NF18335_high_20
[»] chr5 (1 HSPs)
chr5 (1-244)||(14744916-14745164)


Alignment Details
Target: chr5 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 14744916 - 14745164
Alignment:
1 acatgaacaatgagaaaggcaaacagtaacaacgcaacagagagaacgatgctnnnnnnntggcaagaatgacgaatataatgatagctggaatgcactt 100  Q
    ||||||||||||||||||||||||||||||||| ||||| |||||||||||||        |||||||||||||||||||||||||||||||||||||||    
14744916 acatgaacaatgagaaaggcaaacagtaacaacacaacaaagagaacgatgctaaaaaaacggcaagaatgacgaatataatgatagctggaatgcactt 14745015  T
101 gggcaaaaacaa-gatgagtggtaaggggagatgatcagaaacgacgacaa----gagttaaggtaaagatgagttaagaaggcattgagtgaccaagaa 195  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||    |||| ||||||||||||||||||||||||||||||||||||||||    
14745016 gggcaaaaacaatgatgagtggtaaggggagatgatcagaaacgacgacaacaacgagtgaaggtaaagatgagttaagaaggcattgagtgaccaagaa 14745115  T
196 gaagaataaagacgtaaggtttctttttggctgtgttttgagagagaat 244  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||    
14745116 gaagaataaagacgtaagggttctttttggctgtgttttgagagagaat 14745164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University