View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18335_low_20 (Length: 275)
Name: NF18335_low_20
Description: NF18335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18335_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 10589257 - 10589360
Alignment:
| Q |
1 |
ctttaggagatttttcactttatacttttgcaagaatttagtactctattccttgatgaattcttgatagtgctaaccggttcctctgacttcatcaact |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10589257 |
ctttaggagatttttcattttatacttttgcaagaatttagtactctattccttgatgaattcttgatagtgctaaccggttcctctgacttcatcaact |
10589356 |
T |
 |
| Q |
101 |
cctt |
104 |
Q |
| |
|
|||| |
|
|
| T |
10589357 |
cctt |
10589360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University