View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18335_low_20 (Length: 275)

Name: NF18335_low_20
Description: NF18335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18335_low_20
NF18335_low_20
[»] chr8 (1 HSPs)
chr8 (1-104)||(10589257-10589360)


Alignment Details
Target: chr8 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 10589257 - 10589360
Alignment:
1 ctttaggagatttttcactttatacttttgcaagaatttagtactctattccttgatgaattcttgatagtgctaaccggttcctctgacttcatcaact 100  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10589257 ctttaggagatttttcattttatacttttgcaagaatttagtactctattccttgatgaattcttgatagtgctaaccggttcctctgacttcatcaact 10589356  T
101 cctt 104  Q
    ||||    
10589357 cctt 10589360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University