View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18336_low_31 (Length: 285)
Name: NF18336_low_31
Description: NF18336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18336_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 53 - 259
Target Start/End: Complemental strand, 5053824 - 5053618
Alignment:
| Q |
53 |
tgtaatataagggattttaaagtctccacaacagtattgcaaccgcaattttgacatcttattcctgcatttttctgcaatataaaggtttgcaacataa |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
5053824 |
tgtaatataagggattttaaagtctccacaacagtattgcaaccgcaattttgacatcttattcccgcatttttctgcaatataaaggtttgcaacgtaa |
5053725 |
T |
|
| Q |
153 |
ctagaaccactatatataatctatagttggtagtattagttttgtcaccgtcaagggacaatagtagttgtatagttttcagaaattgattcaaattctg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053724 |
ctagaaccactatatataatctatagttggtagtattagttttgccaccgtcgagggacaatagtagttgtatagttttcagaaattgattcaaattctg |
5053625 |
T |
|
| Q |
253 |
tgatgct |
259 |
Q |
| |
|
||||||| |
|
|
| T |
5053624 |
tgatgct |
5053618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 54 - 92
Target Start/End: Complemental strand, 5053866 - 5053828
Alignment:
| Q |
54 |
gtaatataagggattttaaagtctccacaacagtattgc |
92 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
5053866 |
gtaatataagggattttgaagcctccacaacagtattgc |
5053828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University