View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18336_low_43 (Length: 229)
Name: NF18336_low_43
Description: NF18336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18336_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 16 - 215
Target Start/End: Complemental strand, 2636433 - 2636234
Alignment:
| Q |
16 |
atgaatttattaaataagctcgaaatctgcttattatatattattccatagtaattaattgtcttctcaccaaatggaagatatgatcaattcataattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2636433 |
atgaatttattaaataagctcgaaatttgcttattatatattattccatagtaattaattgtcttctcaccaaatggaagatatgatcaattcataattt |
2636334 |
T |
|
| Q |
116 |
acttcataggcattgaacttgctatacatgaataaaattatagctaggtttannnnnnnnnnnggcaaatagctaggtttagttgtctctgatatatatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
2636333 |
acttcataggcattgaacttgctatacatgaataaaattatagctaggtttattattttttttagcaaatagctaggtttaattgtctctaatatatatt |
2636234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University