View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18337_high_4 (Length: 254)
Name: NF18337_high_4
Description: NF18337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18337_high_4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 10 - 254
Target Start/End: Original strand, 25533551 - 25533795
Alignment:
| Q |
10 |
tcgaagaatatccagaaaaataaatgtttcatatctatcacaaatcacaaataaaaaacaacaagaaccatatccaatttcatctccaatttcaacttca |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25533551 |
tcgaaaaatatccagaaaaataaatgtttcatatctatcacaaatcacaaataaaaaacaacaagaaccatatccaatttcatctccaatttcaacttca |
25533650 |
T |
 |
| Q |
110 |
acaatttcaatggagaagtgattaaagacttagtgtcgtttgcataattgacattcctttcactaaacattgctgctatattcaatttagccttatgggt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25533651 |
acaatttcaatggagaagtgattaaagacttagtgtcgtttgcataattgacattcctttcactaaacattgctgctatattcaatttagccttatgggt |
25533750 |
T |
 |
| Q |
210 |
catagnnnnnnnacttattctcttcattaactatcaaatccaaaa |
254 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
25533751 |
catattttttttacttattctcttcattaactatcagatccaaaa |
25533795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University