View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18337_low_1 (Length: 612)
Name: NF18337_low_1
Description: NF18337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18337_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 41534525 - 41534281
Alignment:
| Q |
17 |
caatattcttggaaaaaatttcatcaccgaaattcaaaaacccattgcttccatgcttacaactttaacacaacacaagcatgtcacaaccattgaagct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41534525 |
caatattcttggaaaaaatttcatcaccgaaattcaaaaacccattgcttccatgcttgcaactttaacacaacacaagcatgtcacaaccattgaagct |
41534426 |
T |
 |
| Q |
117 |
tagaacaaaaaatataaaat----aaatgtgacacatgaaatgaaatcaactccacgttgtcaaaccagaataccatcatcaccaactaagca-----ac |
207 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
41534425 |
tagaacaaaaaatataaaataaataaatgtgacacatgaaatgaaatcaactccacgttgtcaaaccagaataccatcatcaccaacgaagcaacctcac |
41534326 |
T |
 |
| Q |
208 |
ctcacctcacgactttgattgaaagaaagaagaatttgcattacc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41534325 |
ctcacctcacgactttgattgaaagaaagaagaatttgcattacc |
41534281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 529 - 612
Target Start/End: Complemental strand, 41534002 - 41533919
Alignment:
| Q |
529 |
atgtttatgttttttcttttgtaaacttctctctgtctgttttctgaagcttactacgaacagatccctatttcttcatttttc |
612 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41534002 |
atgtttatgttttttcttttgtaaacttctctctgtctgttttctgaagcttactacgaacagatccctatttcttcatttttc |
41533919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 277 - 346
Target Start/End: Complemental strand, 41534266 - 41534197
Alignment:
| Q |
277 |
tgatgcgcaaattagcatcatcacacacaaacaggtaatactacgcaccacactcaagataacgctaata |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41534266 |
tgatgcgcaaattagcatcatcacacacaaacaggtaatactacgcaccacactcaagataacgctaata |
41534197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 102 - 150
Target Start/End: Complemental strand, 41538330 - 41538282
Alignment:
| Q |
102 |
acaaccattgaagcttagaacaaaaaatataaaataaatgtgacacatg |
150 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
41538330 |
acaaccactgaagcttaaaacaaaaaatataaaataaatgtgacccatg |
41538282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 35 - 99
Target Start/End: Complemental strand, 41542661 - 41542597
Alignment:
| Q |
35 |
tttcatcaccgaaattcaaaaacccattgcttccatgcttacaactttaacacaacacaagcatg |
99 |
Q |
| |
|
|||||| ||| ||||||||||||||| |||||||||| || ||||||||||| |||||| ||||| |
|
|
| T |
41542661 |
tttcataacccaaattcaaaaacccaatgcttccatgtttgcaactttaacataacacatgcatg |
41542597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 211 - 248
Target Start/End: Complemental strand, 41542553 - 41542516
Alignment:
| Q |
211 |
acctcacgactttgattgaaagaaagaagaatttgcat |
248 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41542553 |
acctcacgactttgaaagaaagaaagaagaatttgcat |
41542516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University