View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18338_high_13 (Length: 240)
Name: NF18338_high_13
Description: NF18338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18338_high_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 86 - 240
Target Start/End: Complemental strand, 4570412 - 4570258
Alignment:
| Q |
86 |
atgtgcatggattggacctggtctaagagtagcagacttgaatattaccattccaagtgccttacgtgatgctaaagtttcaaatttattagatagtaat |
185 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4570412 |
atgtgcatggattgaacctggtctaagagtagcagacttgaatattaccattccaagtgccttacgtgatgctaaagtttcagatttattagatagtaat |
4570313 |
T |
|
| Q |
186 |
ggagcatggaattgggctttgttgaatcattgggtacctgaagacattttggaca |
240 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4570312 |
ggagcatagaattgggctttgttgaatcattgggtacctgaagacattttggaca |
4570258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University