View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18338_high_14 (Length: 237)
Name: NF18338_high_14
Description: NF18338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18338_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 81 - 221
Target Start/End: Complemental strand, 7273164 - 7273025
Alignment:
| Q |
81 |
ccgtaagagtgaaaatgattagttaatggtaagtcaaaatggctacgactccctcatgcttccatttaccaacacatgaatttgtttggaatccattaag |
180 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7273164 |
ccgtaagagtgaaaatgattagt-aatggtaagacaaaatggctacgactccctcatgcttccatttaccaacacatgaatttgtttggaatccattaag |
7273066 |
T |
 |
| Q |
181 |
atgtacacctagcttttgatcttggattatcctcaagaaat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7273065 |
atgtacacctagcttttgatcttggattatcctcaagaaat |
7273025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University